Sequence retrieval

Genome: Rhodomicrobium equis 103S
Start position: 1603368
End position: 1603391
Length: 24

DNA sequence
>NC_014659, from 1603368 to 1603391 (24 bp); Rhodomicrobium equis 103S CGATGCGGCGCTGCGGCGATTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1603055-1603987	Sequence	REQ_15320 - hydroxymethylglutaryl-CoA synthase (Protein is coded in complementary strand; from 1603987 to 1603055)