Sequence retrieval

Genome: Rhodomicrobium equis 103S
Start position: 1804729
End position: 1804752
Length: 24

DNA sequence
>NC_014659, from 1804729 to 1804752 (24 bp); Rhodomicrobium equis 103S CGTCGACGTCGCCGGCGAGGTCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1804584-1804949	Sequence	REQ_17080 - hypothetical protein (Protein is coded in complementary strand; from 1804949 to 1804584)