Sequence retrieval

Genome: Rhodomicrobium equis 103S
Start position: 1833658
End position: 1833681
Length: 24

DNA sequence
>NC_014659, from 1833658 to 1833681 (24 bp); Rhodomicrobium equis 103S CTGGTCCGGGTCCCGGTCCTCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1833239-1836562	Sequence	REQ_17370 - indolylacetylinositol arabinosyltransferase (Protein is coded in complementary strand; from 1836562 to 1833239)