Sequence retrieval

Genome: Rhodomicrobium equis 103S
Start position: 1840743
End position: 1840766
Length: 24

DNA sequence
>NC_014659, from 1840743 to 1840766 (24 bp); Rhodomicrobium equis 103S CGACGACGGCGACGACGGCGCCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1840007-1840987	Sequence	REQ_17410 - membrane protein (Protein is coded in complementary strand; from 1840987 to 1840007)