Sequence retrieval

Genome: Rhodomicrobium equis 103S
Start position: 200446
End position: 200469
Length: 24

DNA sequence
>NC_014659, from 200446 to 200469 (24 bp); Rhodomicrobium equis 103S GTACGGGCACGGCTACGGGCACGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 200238-201947	Sequence	REQ_01910 lytB mannosyl-glycoprotein endo-beta-n-acetylglucosaminidase lytb