Sequence retrieval

Genome: Rhodomicrobium equis 103S
Start position: 248367
End position: 248390
Length: 24

DNA sequence
>NC_014659, from 248367 to 248390 (24 bp); Rhodomicrobium equis 103S AGCGCGATCGCGATCGCGATCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 247404-249251	Sequence	REQ_02200 - hypothetical protein (Protein is coded in complementary strand; from 249251 to 247404)