Sequence retrieval

Genome: Rhodomicrobium equis 103S
Start position: 25462
End position: 25485
Length: 24

DNA sequence
>NC_014659, from 25462 to 25485 (24 bp); Rhodomicrobium equis 103S GGTCGTGGTGGTCGTCGTGGTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 25340-26707	Sequence	REQ_00240 pknA serine/threonine kinase pkna (Protein is coded in complementary strand; from 26707 to 25340)