Sequence retrieval

Genome: Rhodomicrobium equis 103S
Start position: 2925524
End position: 2925547
Length: 24

DNA sequence
>NC_014659, from 2925524 to 2925547 (24 bp); Rhodomicrobium equis 103S TCCGCGGCCGCGGCCGCGGCCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2924627-2925979	Sequence	REQ_27520 - threonine ammonia-lyase (Protein is coded in complementary strand; from 2925979 to 2924627)