Sequence retrieval

Genome: Rhodomicrobium equis 103S
Start position: 2949527
End position: 2949550
Length: 24

DNA sequence
>NC_014659, from 2949527 to 2949550 (24 bp); Rhodomicrobium equis 103S CGTCGTCGTCCTCGCCGTCCTCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2949499-2950728	Sequence	REQ_27760 ftsZ cell division protein ftsz (Protein is coded in complementary strand; from 2950728 to 2949499)