Sequence retrieval

Genome: Rhodomicrobium equis 103S
Start position: 29678
End position: 29701
Length: 24

DNA sequence
>NC_014659, from 29678 to 29701 (24 bp); Rhodomicrobium equis 103S GGGCGCGGGCGTCGGCGCGGGTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 29637-31070	Sequence	REQ_00270 - protein phosphatase (Protein is coded in complementary strand; from 31070 to 29637)