Sequence retrieval

Genome: Rhodomicrobium equis 103S
Start position: 304769
End position: 304792
Length: 24

DNA sequence
>NC_014659, from 304769 to 304792 (24 bp); Rhodomicrobium equis 103S CGCCGACGGCGATGCCGACGCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 303724-305094	Sequence	REQ_02770 - hypothetical protein (Protein is coded in complementary strand; from 305094 to 303724)