Sequence retrieval

Genome: Rhodomicrobium equis 103S
Start position: 3167731
End position: 3167754
Length: 24

DNA sequence
>NC_014659, from 3167731 to 3167754 (24 bp); Rhodomicrobium equis 103S GCGACGGCGACGACGACGGCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3165509-3168982	Sequence	REQ_29850 - ribonuclease e and g (Protein is coded in complementary strand; from 3168982 to 3165509)