Sequence retrieval

Genome: Rhodomicrobium equis 103S
Start position: 3290526
End position: 3290549
Length: 24

DNA sequence
>NC_014659, from 3290526 to 3290549 (24 bp); Rhodomicrobium equis 103S GCCGGCTCCGGCGCAGGCTCCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3289497-3290990	Sequence	REQ_30940 - signal recognition particle protein (Protein is coded in complementary strand; from 3290990 to 3289497)