Sequence retrieval

Genome: Rhodomicrobium equis 103S
Start position: 3293653
End position: 3293676
Length: 24

DNA sequence
>NC_014659, from 3293653 to 3293676 (24 bp); Rhodomicrobium equis 103S CGGCCGCCGCCGCGGCGGCGGCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3291708-3295310	Sequence	REQ_30960 smc chromosome segregation protein smc (Protein is coded in complementary strand; from 3295310 to 3291708)