Sequence retrieval

Genome: Rhodomicrobium equis 103S
Start position: 3720659
End position: 3720682
Length: 24

DNA sequence
>NC_014659, from 3720659 to 3720682 (24 bp); Rhodomicrobium equis 103S GTGGGCGTGGCCGTGGCCGTGGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3720657-3722270	Sequence	REQ_35020 groEL molecular chaperone GroEL (Protein is coded in complementary strand; from 3722270 to 3720657)