Sequence retrieval

Genome: Rhodomicrobium equis 103S
Start position: 3932967
End position: 3932990
Length: 24

DNA sequence
>NC_014659, from 3932967 to 3932990 (24 bp); Rhodomicrobium equis 103S GCCGACGGCGACGCCGACGCCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3932869-3933729	Sequence	REQ_36790 yrbE4B hypothetical protein (Protein is coded in complementary strand; from 3933729 to 3932869)