Sequence retrieval

Genome: Rhodomicrobium equis 103S
Start position: 4148167
End position: 4148190
Length: 24

DNA sequence
>NC_014659, from 4148167 to 4148190 (24 bp); Rhodomicrobium equis 103S CCAGCGCCAGCCACAGCGCCACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4147734-4148939	Sequence	REQ_39080 - hypothetical protein (Protein is coded in complementary strand; from 4148939 to 4147734)