Sequence retrieval

Genome: Rhodomicrobium equis 103S
Start position: 4262638
End position: 4262661
Length: 24

DNA sequence
>NC_014659, from 4262638 to 4262661 (24 bp); Rhodomicrobium equis 103S GGCGGCCGCGGCGGTGGCGTCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4262150-4262692	Sequence	REQ_40270 grpE chaperone protein cofactor grpe (Protein is coded in complementary strand; from 4262692 to 4262150)