Sequence retrieval

Genome: Rhodomicrobium equis 103S
Start position: 4444996
End position: 4445019
Length: 24

DNA sequence
>NC_014659, from 4444996 to 4445019 (24 bp); Rhodomicrobium equis 103S TGACCGTGGCCGTGGCCGTGGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4444303-4445118	Sequence	REQ_41820 hypB hydrogenase accessory protein hypb (Protein is coded in complementary strand; from 4445118 to 4444303)