Sequence retrieval

Genome: Rhodomicrobium equis 103S
Start position: 4491552
End position: 4491575
Length: 24

DNA sequence
>NC_014659, from 4491552 to 4491575 (24 bp); Rhodomicrobium equis 103S TCGGCGTTGGCGTCGGCGTCGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4491120-4492778	Sequence	REQ_42280 - acyl-CoA ligase (Protein is coded in complementary strand; from 4492778 to 4491120)