Sequence retrieval

Genome: Rhodomicrobium equis 103S
Start position: 4789394
End position: 4789417
Length: 24

DNA sequence
>NC_014659, from 4789394 to 4789417 (24 bp); Rhodomicrobium equis 103S CGACCGCGGCCGCGAGCGCGAACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4788049-4789647	Sequence	REQ_44970 - copper oxidase (Protein is coded in complementary strand; from 4789647 to 4788049)