Sequence retrieval

Genome: Rhodomicrobium equis 103S
Start position: 4825789
End position: 4825812
Length: 24

DNA sequence
>NC_014659, from 4825789 to 4825812 (24 bp); Rhodomicrobium equis 103S GTGCGGATGCGGGTGAGGGTGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4825078-4826055	Sequence	REQ_45330 - hypothetical protein (Protein is coded in complementary strand; from 4826055 to 4825078)