Sequence retrieval

Genome: Rhodomicrobium equis 103S
Start position: 4835126
End position: 4835149
Length: 24

DNA sequence
>NC_014659, from 4835126 to 4835149 (24 bp); Rhodomicrobium equis 103S GTGGCCGTGACCGTGGCCGTGGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4835124-4835870	Sequence	REQ_45400 - hypothetical protein (Protein is coded in complementary strand; from 4835870 to 4835124)