Sequence retrieval

Genome: Rhodomicrobium equis 103S
Start position: 4864459
End position: 4864482
Length: 24

DNA sequence
>NC_014659, from 4864459 to 4864482 (24 bp); Rhodomicrobium equis 103S GCAGCAGCGGCATCAGCAGCAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4864062-4865255	Sequence	REQ_45730 - amidohydrolase (Protein is coded in complementary strand; from 4865255 to 4864062)