Sequence retrieval

Genome: Rhodomicrobium equis 103S
Start position: 714094
End position: 714117
Length: 24

DNA sequence
>NC_014659, from 714094 to 714117 (24 bp); Rhodomicrobium equis 103S CGATCCCGAACCCGATGCCGCTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 713319-714182	Sequence	REQ_06870 - short chain dehydrogenase (Protein is coded in complementary strand; from 714182 to 713319)