Sequence retrieval

Genome: Rhodomicrobium equis 103S
Start position: 811603
End position: 811626
Length: 24

DNA sequence
>NC_014659, from 811603 to 811626 (24 bp); Rhodomicrobium equis 103S GGCGCCGGCGCAGGTGCCGGCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 811255-811860	Sequence	REQ_07680 - membrane protein (Protein is coded in complementary strand; from 811860 to 811255)