Sequence retrieval

Genome: Rhodomicrobium equis 103S
Start position: 926229
End position: 926252
Length: 24

DNA sequence
>NC_014659, from 926229 to 926252 (24 bp); Rhodomicrobium equis 103S GTCGGTGTAGGTGCCGGTGTCGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 925141-927120	Sequence	REQ_08690 - LytR family transcripiotnal regulator (Protein is coded in complementary strand; from 927120 to 925141)