Sequence retrieval

Genome: Rhodomicrobium equis 103S
Start position: 961999
End position: 962022
Length: 24

DNA sequence
>NC_014659, from 961999 to 962022 (24 bp); Rhodomicrobium equis 103S GTCGGCGCCGGCGTCCGCGTAGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 961652-962590	Sequence	REQ_09050 prpB 2-methylcitrate lyase prpb (Protein is coded in complementary strand; from 962590 to 961652)