Sequence retrieval

Genome: Rhodomicrobium equis 103S
Start position: 973516
End position: 973539
Length: 24

DNA sequence
>NC_014659, from 973516 to 973539 (24 bp); Rhodomicrobium equis 103S GGCGTCGTCGTCGGCGCCGGCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 972935-974077	Sequence	REQ_09120 - aminoglycoside phosphotransferase (Protein is coded in complementary strand; from 974077 to 972935)