Sequence retrieval

Genome: Rhodomicrobium equis 103S
Start position: 2423679
End position: 2423703
Length: 25

DNA sequence
>NC_014659, from 2423679 to 2423703 (25 bp); Rhodomicrobium equis 103S GCCGTGCCCTGCCGCGCCGTGCCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2423119-2424375	Sequence	REQ_23030 - divalent cation transporter (Protein is coded in complementary strand; from 2424375 to 2423119)