Sequence retrieval

Genome: Rhodomicrobium equis 103S
Start position: 4957608
End position: 4957632
Length: 25

DNA sequence
>NC_014659, from 4957608 to 4957632 (25 bp); Rhodomicrobium equis 103S ACCCGGCCCGGCCCGAGCCGACCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4957185-4958417	Sequence	REQ_46660 - acyl-CoA dehydrogenase (Protein is coded in complementary strand; from 4958417 to 4957185)