Sequence retrieval

Genome: Rhodomicrobium equis 103S
Start position: 201605
End position: 201631
Length: 27

DNA sequence
>NC_014659, from 201605 to 201631 (27 bp); Rhodomicrobium equis 103S CTGCCCCCGTTGCCCCCGCTGCCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 200238-201947	Sequence	REQ_01910 lytB mannosyl-glycoprotein endo-beta-n-acetylglucosaminidase lytb