Sequence retrieval

Genome: Rhodomicrobium equis 103S
Start position: 2430380
End position: 2430406
Length: 27

DNA sequence
>NC_014659, from 2430380 to 2430406 (27 bp); Rhodomicrobium equis 103S CCGCCGACTCCGCTGACTCGGCCGACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2430058-2431470	Sequence	REQ_23060 - hypothetical protein (Protein is coded in complementary strand; from 2431470 to 2430058)