Sequence retrieval

Genome: Rhodomicrobium equis 103S
Start position: 3283502
End position: 3283528
Length: 27

DNA sequence
>NC_014659, from 3283502 to 3283528 (27 bp); Rhodomicrobium equis 103S TTCTTGCCCTTCTTCCCCTTCTTGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3283313-3284893	Sequence	REQ_30900 - signal recognition particle protein (Protein is coded in complementary strand; from 3284893 to 3283313)