Sequence retrieval

Genome: Rhodomicrobium equis 103S
Start position: 3706260
End position: 3706286
Length: 27

DNA sequence
>NC_014659, from 3706260 to 3706286 (27 bp); Rhodomicrobium equis 103S GGCACGGCGGGAACGGCGGGAACGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3704994-3706316	Sequence	REQ_34860 - pspc family two component system sensor kinase (Protein is coded in complementary strand; from 3706316 to 3704994)