Sequence retrieval

Genome: Rhodomicrobium equis 103S
Start position: 649437
End position: 649463
Length: 27

DNA sequence
>NC_014659, from 649437 to 649463 (27 bp); Rhodomicrobium equis 103S GAAGACACCGAAGACCCCGAAGACACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 648555-649445	Sequence	REQ_06230 - hhh-gpd family DNA repair protein (Protein is coded in complementary strand; from 649445 to 648555)