Sequence retrieval

Genome: Rhodomicrobium equis 103S
Start position: 3763004
End position: 3763033
Length: 30

DNA sequence
>NC_014659, from 3763004 to 3763033 (30 bp); Rhodomicrobium equis 103S CTGGCACTGGCACCGGCACTGGCACTGGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3762134-3763546	Sequence	REQ_35460 - esx cluster membrane protein (Protein is coded in complementary strand; from 3763546 to 3762134)