Sequence retrieval

Genome: Rhodomicrobium equis 103S
Start position: 4261765
End position: 4261794
Length: 30

DNA sequence
>NC_014659, from 4261765 to 4261794 (30 bp); Rhodomicrobium equis 103S CCGCCGTCGCCGCCGGCGGCGCCGCCACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4260946-4262115	Sequence	REQ_40260 dnaJ2 molecular chaperone DnaJ (Protein is coded in complementary strand; from 4262115 to 4260946)