Sequence retrieval

Genome: Rhodomicrobium equis 103S
Start position: 811552
End position: 811581
Length: 30

DNA sequence
>NC_014659, from 811552 to 811581 (30 bp); Rhodomicrobium equis 103S GCAGGTGCAGGTGCAGGTGCAGGTGCAGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 811255-811860	Sequence	REQ_07680 - membrane protein (Protein is coded in complementary strand; from 811860 to 811255)