Sequence retrieval

Genome: Rhodomicrobium equis 103S
Start position: 1891084
End position: 1891116
Length: 33

DNA sequence
>NC_014659, from 1891084 to 1891116 (33 bp); Rhodomicrobium equis 103S CCCGCCGTCATACCGCTGTCATACCGCCGTCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1891114-1893171	Sequence	REQ_17800 - ATP-dependent DNA helicase (Protein is coded in complementary strand; from 1893171 to 1891114)