Sequence retrieval

Genome: Rhodomicrobium equis 103S
Start position: 2046978
End position: 2047010
Length: 33

DNA sequence
>NC_014659, from 2046978 to 2047010 (33 bp); Rhodomicrobium equis 103S CCATGACGTCAGCATGACGCCATCGTGACGTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 2046482-2046982	Sequence	REQ_19390 - hypothetical protein (Protein is coded in complementary strand; from 2046982 to 2046482)