Sequence retrieval

Genome: Rhodomicrobium equis 103S
Start position: 4043146
End position: 4043178
Length: 33

DNA sequence
>NC_014659, from 4043146 to 4043178 (33 bp); Rhodomicrobium equis 103S CAGCCGAGACTCAGCCGTGCCTCACCCGAGACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 4043179-4044366	Sequence	REQ_38020 - lipoprotein (Protein is coded in complementary strand; from 4044366 to 4043179)