Sequence retrieval

Genome: Rhodomicrobium equis 103S
Start position: 1421731
End position: 1421766
Length: 36

DNA sequence
>NC_014659, from 1421731 to 1421766 (36 bp); Rhodomicrobium equis 103S TGGTCGGCCAGCTGGACGGCCAGATTGTCGGCCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1421260-1422036	Sequence	REQ_13680 - phosphoglycerate mutase family protein (Protein is coded in complementary strand; from 1422036 to 1421260)