Sequence retrieval

Genome: Rhodomicrobium equis 103S
Start position: 2151926
End position: 2151961
Length: 36

DNA sequence
>NC_014659, from 2151926 to 2151961 (36 bp); Rhodomicrobium equis 103S GAACGTGAACATCAGCGTGAACATGATCGGGAACAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2151294-2152124	Sequence	REQ_20440 - ABC transporter transmembrane protein (Protein is coded in complementary strand; from 2152124 to 2151294)