Sequence retrieval

Genome: Rhodomicrobium equis 103S
Start position: 3224082
End position: 3224117
Length: 36

DNA sequence
>NC_014659, from 3224082 to 3224117 (36 bp); Rhodomicrobium equis 103S CCACGAGGGCGGCGACGAGGCCGGCGACGAGGCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3222170-3224200	Sequence	REQ_30380 - hypothetical protein (Protein is coded in complementary strand; from 3224200 to 3222170)