Sequence retrieval

Genome: Rhodomicrobium equis 103S
Start position: 1988695
End position: 1988739
Length: 45

DNA sequence
>NC_014659, from 1988695 to 1988739 (45 bp); Rhodomicrobium equis 103S TCGGTGTCGTGGTGCTCGGTGTCGTGGTGCTCGGTGTCGTGGTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1987188-1989245	Sequence	REQ_18820 - membrane protein (Protein is coded in complementary strand; from 1989245 to 1987188)