Sequence retrieval

Genome: Rhodomicrobium equis 103S
Start position: 2136451
End position: 2136495
Length: 45

DNA sequence
>NC_014659, from 2136451 to 2136495 (45 bp); Rhodomicrobium equis 103S GGTGGTCTTCTTGGCCGCGGTCTTCTTGGCGGCGGCCTTCTTCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2135288-2136667	Sequence	REQ_20270 sigA sigma-70 factor siga (Protein is coded in complementary strand; from 2136667 to 2135288)