Sequence retrieval

Genome: Rhodomicrobium equis 103S
Start position: 32147
End position: 32191
Length: 45

DNA sequence
>NC_014659, from 32147 to 32191 (45 bp); Rhodomicrobium equis 103S CTGCTGGTCGTAGCCCTGCTGGTACTCGCCCTGCGGCTGGTAGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 31698-33038	Sequence	REQ_00290 - hypothetical protein (Protein is coded in complementary strand; from 33038 to 31698)