Sequence retrieval

Genome: Rhodomicrobium equis 103S
Start position: 4020140
End position: 4020184
Length: 45

DNA sequence
>NC_014659, from 4020140 to 4020184 (45 bp); Rhodomicrobium equis 103S ACTTGTGATCGTCGGCCTTGCGGTCGTCGGCCCTGTGATCGTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4019647-4020762	Sequence	REQ_37760 - hypothetical protein (Protein is coded in complementary strand; from 4020762 to 4019647)