Sequence retrieval

Genome: Rhodomicrobium equis 103S
Start position: 4229987
End position: 4230031
Length: 45

DNA sequence
>NC_014659, from 4229987 to 4230031 (45 bp); Rhodomicrobium equis 103S CGGGTACGCCTGCGTCGGGTACGCCTGCGTCGGGTACGCCTGCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4229343-4230245	Sequence	REQ_39940 - membrane protein (Protein is coded in complementary strand; from 4230245 to 4229343)